TweetFollow Us on Twitter

Oct 96 Challenge
Volume Number:12
Issue Number:10
Column Tag:Programmer’s Challenge

Programmer’s Challenge

By Bob Boonstra

Note: Source code files accompanying article are located on MacTech CD-ROM or source code disks.

DNA Match

This month’s Challenge is based on a suggestion submitted by Vicente Giles of the Universidad de Málaga. Vincente faces a real-world problem to look for all the genomic sequences that match certain

criteria, given a DNA database sequence and a problem sequence. A DNA sequence is a string of the four different nucleotides involved in the genetic code, denoted ‘A’, ‘C’, ‘G’, and ‘U’, which stand for adenine, cytosine, guanine, and uracil. The problem is to find all possible matches of the problem sequence in the database sequence, allowing a specified number of differences.

The prototype for the code you should write is:

long FindMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage,  /* storage preallocated for your use */
 char *fragment, /* string to match against database */
 long diffsAllowed,/* differences allowed between fragment and database */
 long matchPosition[]/* return match positions in this array*/
);

void InitMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage   /* storage preallocated for your use */
);

Because we would like our DNA-matching algorithm to be useful even if scientists discover an extraterrestrial genetic code based on other nucleotides, the algorithm accepts the genetic alphabet as a parameter. In the problem posed by Vincente, this would be the string “ACGU”, but in our Challenge it might include any of the characters ‘a’..’z’ or ‘A’..’Z’ (Extraterrestrial DNA is case sensitive). The null-terminated reference string contained in the database parameter can be up to 1000000000 (109) characters long. The fragment that you are to match is also null-terminated, but will be significantly shorter on average (up to 10000 characters) than the database string. You should compare the input fragment against database, finding all occurrences of fragment that differ in no more than diffsAllowed positions from a substring of database. Your code should populate one entry in the preallocated matchPosition array for each match found, storing the offset of the character in database that corresponds to the first character of fragment. The FindMatch function should return the number of matches found.

As an example, given the following input

alphabet: ACGU

database: ACGTACGTACGTAAAAAATACGTACGTATA

fragment: ACGTACGTAC

diffsAllowed: 5

your code should find 7 matches and store the following values in matchPosition:

-4 0 4 8 15 19 23


Notice that partial matches can occur at the beginning or the end of database, and as a result, the offsets returned in matchPosition can be negative or greater than strlen(database) - strlen(fragment).

To allow you to do some preprocessing, your InitMatch routine will be called once before a sequence of calls to FindMatch. InitMatch will be called with the same alphabet and database parameters provided to subsequent FindMatch calls. Both routines will also be given the same storage parameter that points to at least 1MB of memory allocated and initialized to zero by the calling routine. FindMatch will be called between 100 and 1000 times, on average, for each call to InitMatch. The winning solution will be the one with the fastest execution time, including the execution time for both InitMatch and FindMatch.

Other fine print: The alphabet characters will be provided in increasing ASCII order. The offsets you store in matchPosition need not be in any particular order. The value for diffsAllowed will typically be smaller than 50% of strlen(fragment). Finally, you should not allocate any dynamic storage in your solution beyond that provided in the storage parameter.

This will be a native PowerPC Challenge using the latest Symantec environment. Solutions may be coded in C or C++.

Two Months Ago Winner

Congratulations to Randy Boring for submitting the fastest entry to the A-Maze-ing Programmer’s Challenge. The Challenge this month was to write code that would find a path leading out of a three-dimensional maze. The solutions were provided with the maze size, an initial position, some storage for use in mapping the maze, and a callback routine. The callback provided the result of attempting to move in a given direction, indicating whether the attempt to move succeeded, failed because there was no opening in the specified direction, resulted in a fall down a shaft in the mine, or found an exit to the mine. Of the four entries submitted, only two successfully solved all of my test mazes; one of the entries crashed, and one went into an infinite loop.

The table below summarizes the results for each correct entry, including the language in which the solution was written, the size of the solution code, the amount of static data used by the solution, the total execution time for all test cases, and the number of moves needed to solve the mazes.

Name Language Code Size Data Size Time Moves

Randy Boring C++ 2792 484 343153 33519

Jay Negro C++ 1788 51 40945114 7120802

The test mazes used in the evaluation ranged in size from 10x20x30 to 100x100x200, and ranged in density (the percentage of open cells) from 10% to 20%. As indicated in the problem statement, a path to an exit was guaranteed to exist from any cell reachable from the starting position.

Randy’s winning entry spent more time processing each move than the second place entry from first-time Challenge contestant Jay Negro, but Randy’s code solved the maze using significantly fewer moves and executed two orders of magnitude more quickly. His code maintains a queue of what are believed to be the best moves to try. As long as there are moves in the best move list, it invokes the callback with the best move, checks for success, and then updates the map with what it has learned about the maze position it just tried. The CalcBestMove routine determines the best possible move (surprise!) by first moving toward an adjacent maze boundary if one exists, or moving toward the nearest maze boundary if nothing is known about the current position, or trying adjacent positions about which nothing is known, or finally by moving toward a position about which nothing is known. The CalcBestMove heuristics, along with judicious use of inline functions and some optimization of maze offset calculations, combined to make this an efficient solution.

Careful readers of the code will note one potential problem with the Initialize routine, in that it simply gives up and returns if it is unable to allocate enough memory. This could have caused the winning entry to fail for larger mazes when given only the amount of memory guaranteed by the problem. However, the size of the mazes that I could practically evaluate was limited by the speed of the other entries, and the memory problem did not show up with those cases, so I elected to ignore it. Under other circumstances, proper handling of low memory conditions would have been required to win.

TOP 20 CONTESTANTS

Here are the Top 20 Contestants for the Programmer’s Challenge. The numbers below include points awarded over the 24 most recent contests, including points earned by this month’s entrants.

RankNamePoints
1.Munter, Ernst193
2.Gregg, Xan92
3.Larsson, Gustav87
4.[Name deleted]60
5.Lengyel, Eric40
6.Lewis, Peter30
7.Boring, Randy27
8.Beith, Gary24
9.Kasparian, Raffi22
10.Vineyard, Jeremy22
11.Cutts, Kevin21
12.Picao, Miguel Cruz21
13.Brown, Jorg20
14.Gundrum, Eric20
15.Karsh, Bill19
16.Stenger, Allen19
17.Cooper, Greg17
18.Mallett, Jeff17
19.Nevard, John17
20.Nicolle, Ludovic14

There are three ways to earn points: (1) scoring in the top 5 of any Challenge, (2) being the first person to find a bug in a published winning solution or, (3) being the first person to suggest a Challenge that I use. The points you can win are:

1st place20 points
2nd place10 points
3rd place7 points
4th place4 points
5th place2 points
finding bug2 points
suggesting Challenge2 points

Here is Randy’s winning solution:

Amazing.cp

Copyright © 1996 Randy Boring

typedef Boolean (*MoveProc) (
 long xMove,long yMove,long zMove,
 long *newXPos,long *newYPos,long *newZPos
 );

// the MoveProc, MakeAMove, is a callback.  It returns true if you 
// have found your way out of the maze.
// You give it (x,y,z) as a delta from your current position,
// each from [-1, 0, 1].  Straight up and straight down (and all zeroes)
// always result in no movement. 

Boolean Maze (long xMove, // these are your initial position
 long yMove,
 long zMove,
 long xSize,// these are the dimensions of the maze
 long ySize,
 long zSize,
 MoveProc MakeAMove, // this is your callback routine
 char *mapStorage// this is your preallocated storage
 );// (one char per position in maze)

Typedefs and Constants
typedef long dirT; // direction enumerator (0-24)

static
const long dir2dx[25]={9,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,};
static
const long dir2dy[25]={9, 
 1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,};
static
const long dir2dz[25]={9,
  1, 1, 1,   1, 1,   1, 1, 1,
  0, 0, 0,   0, 0,   0, 0, 0,
 -1,-1,-1,  -1,-1,  -1,-1,-1,};
static
const dirT di[3][3][3] = {
  {{1,2,3},{4,0,5},{6,7,8}},
  {{9,10,11},{12,0,13},{14,15,16}},
  {{17,18,19},{20,0,21},{22,23,24}}};
static const dirT kNoDir = 0;
static const dirT kFirstDir = 1;
static const dirT kLastDir = 24;
static const dirT kNumDirs = 25; // including kNoDir at zero
static const char kUnknown = 0;  // unknown square
    // every type below is known
static const char kWall = 1;// wall
static const char kSpace = 2; // space-above-wall
static const char kFall = 4;// space-above-space
static const char kTriedSpace = 10;// searched space
static const char kTriedFall = 12; // searched fall

static const short kTakeProb = 4;  // 1/4th
static const long kSTNBlockSize = 48;

typedef long squareIndexT;
typedef struct STN {
 struct STN *parent;
 squareIndexT square;// square index of this node
 dirT   direction; // how I got here from my parent
 } SearchTreeNode, *STNPtr, **STNHandle;

Globals
static STNPtr gTreeRoot;
static STNPtr gTreeTop;
static STNPtr gQHead;
static STNPtr gQTail;
static STNPtr gBestMoveList;
static STNHandle gTreeRootH;
static STNHandle gBestMoveListH;
static STNPtr gBestMoveListNextPos;

Defines 
#define myIsUnknown(sq) (kUnknown == (sq))
#define myIsKnown(sq)(kUnknown != (sq))
    // the below should only be used when the square is known
#define myIsWall(sq) (kWall == (sq))
#define myIsUntriedWalkable(sq)  (kSpace == (sq))
#define myIsOpen(sq) (0x00 == (0x01 & (sq)))
#define myIsWalkable(sq) (0x02 == (0x02 & (sq)))
#define myIsUntriedFall(sq) (kFall == (sq))
#define myIsFall(sq) (0x04 == (0x04 & (sq)))
#define myIsTried(sq)(0x08 == (0x08 & (sq)))
#define d2x(d) (dir2dx[d])
#define d2y(d) (dir2dy[d])
#define d2z(d) (dir2dz[d])
#define xvec(d) (d2x(d))
#define yvec(d,xN) (d2y(d) * (xN))
#define zvec(d,xyN) (d2z(d) * (xyN))
#define offsetD(d,xN,xyN) (xvec(d) + yvec(d,xN) + zvec(d,xyN))
#define offsetXYZ(x,y,z,xN,xyN) ((x) + (y) * xN + (z) * (xyN))
#define map(m,x,y,z,xN,xyN) (*(m + (x) + (y) * xN + (z) * (xyN)))

#ifdef powerc
#define BreakToSourceDebugger_()   Debugger()
#else   // 68K
#define BreakToSourceDebugger_()   SysBreak()
#endif  // powerc


isEmptySearchQ
static inline Boolean
isEmptySearchQ() {return (gQHead == gQTail);}

isFullSearchQ
static inline Boolean
isFullSearchQ() {return (gTreeTop <= gQTail);}

DeQ
static inline STNPtr
DeQ(void) {return gQHead++;}

EnQ
static inline STNPtr
EnQ(void) {
 STNPtr p = gQTail++;
    //if (isFullSearchQ())
    //    BreakToSourceDebugger_();
 return (p);
}

EnQNewCandidate
// Add this move (direction to a square index) to the tree at the current node, assumes 
// the square index has not already been visited by this search.
static void
EnQNewCandidate(STNPtr parent, const long sqi, 
 const dirT d)
{
STNPtr newNode = EnQ();
newNode->parent = parent;
newNode->direction = d;
newNode->square = sqi;
}

isEmptySearchTree
static inline Boolean
isEmptySearchTree() {return (gTreeRoot == gQTail);}

PopSearchTree
static inline long
PopSearchTree(void) {return ((-gQTail)->square);}

NewSearchTree
static void
NewSearchTree(void) {
 gQTail = gQHead = gTreeRoot;
 gQTail++;// the only time we’re called,
}//  gTreeRoot is immediately the EnQed elem.

DisposeSearchTree
static void
DisposeSearchTree(char *m) {
while (!isEmptySearchTree()) {
    // remove ‘tried’ mark
 *(m + PopSearchTree()) = kSpace;
 }
}

isEmptyMoveList
static inline Boolean
isEmptyMoveList()
 {return (gBestMoveListNextPos == gBestMoveList);}

PushMoveList
static inline void
PushMoveList(const dirT d) {
 gBestMoveListNextPos->direction = d;
 gBestMoveListNextPos++;}

PopMoveList
static inline dirT
PopMoveList(void) {
 -gBestMoveListNextPos;
 return (gBestMoveListNextPos->direction);}

NewBestMoveList
static void
NewBestMoveList(void) {gBestMoveListNextPos = gBestMoveList;}

SetBestMove
// Copy the sequence of best directions-to-move to the
// best move list.  (The tree is about to be freed.)
static void
SetBestMove(STNPtr node, const dirT d)
{
PushMoveList(d);
while (kNoDir != node->direction) { // the root’s dir
 PushMoveList(node->direction);
 node = node->parent;
 }
}

Initialize
// Initialize everything for the routine
// map is already initialized to zeroes (kUnknown == 0)
static Boolean
Initialize(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
const long xySize = xSize * ySize;
long treeBytesWanted = sizeof(SearchTreeNode)
 * ((xSize - 2) * (ySize - 2) * (zSize - 2) + 4);
long treeBytesNeeded = sizeof(SearchTreeNode)
 * ((xSize - 2) + (ySize - 2) + (zSize - 2) + 1);
Boolean succeed = true;

map(m,x,y,z,xSize,xySize) = kSpace;
map(m,x,y,z-1,xSize,xySize) = kWall;

gBestMoveListH = (STNHandle) NewHandle(sizeof(SearchTreeNode)
 * (zSize + xySize) * 2);
if (!gBestMoveListH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gBestMoveListH);
gBestMoveList = *gBestMoveListH;

do {
 gTreeRootH = (STNHandle) NewHandle(treeBytesWanted);
 treeBytesWanted *= 0.9;
 }
 while (!gTreeRootH && 
 (treeBytesNeeded <= treeBytesWanted));
if (!gTreeRootH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gTreeRootH);
gTreeRoot = *gTreeRootH;

NewBestMoveList();
return succeed;
}


DeInitialize
// Free everything we allocated
static void
DeInitialize()
{
HUnlock((Handle) gBestMoveListH);
DisposeHandle((Handle) gBestMoveListH);
HUnlock((Handle) gTreeRootH);
DisposeHandle((Handle) gTreeRootH);
}


AtEdge
// Are we at an edge?
// return true if we are
static Boolean
AtEdge(const long x, const long y, const long z,
 const long xMax, const long yMax, const long zMax)
{
if (0==x || 0==y || 0==z) return true;
if (xMax==x || yMax==y || zMax==z) return true;
return false;
}


MapMove
// Map the move we just made/tried.
// I.e., store our new knowledge of the maze in the map
static void
MapMove(const long oldx, const long oldy, const long oldz,
 const long newx, const long newy, const long newz,
 char *m, const long xN, const long xyN,
 const long dx, const long dy, const long dz)
{
long x = oldx + dx; // where we tried to move
long y = oldy + dy; // (we need these in either case below)
long z = oldz + dz;
long sqi = offsetXYZ(x, y, z, xN, xyN);
if (newx==oldx && newy==oldy && newz==oldz) { // bump!
    // mark as wall the square we bumped into
 *(m + sqi) = kWall;
    // lastTried was not successful
    //gLastWasSuccess = false;
 }
else {
    // mark as clear any squares we fell through
    // actually mark them with as fall because they can’t
    // really be moved ‘to’ only through, downwards.
 if (newz < z) {
 do {
 *(m + sqi) = kFall;
 z-;
 sqi -= xyN;
 } while (newz < z);
 }
    // mark as clear our current space
 *(m + sqi) = kSpace;
    // mark as ‘wall’ the square we are standing on
 sqi -= xyN;
 *(m + sqi) = kWall;
    // lastTried was successful
    //gLastWasSuccess = true;
    // direction of last success
    //gLastSuccess = lastTried;
 }
}


APossibleExit
// return a direction in which
// there may be an adjacent exit.
// A possible exit must be both an edge and untried.
static dirT
APossibleExit(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m, dirT lastTried)
{
dirT tryD = lastTried + 1; // start here
/* check for edge conditions first */
if (x > 1 && x < xSize - 2)
 if (y > 1 && y < ySize - 2)
 if (z > 1 && z < zSize - 2)
    /* no exits are possibly nearby */
    /* because no edges are nearby */
 return kNoDir; // zero

/* search the adjacent spaces for a possible exit */
/* this could improve a lot */
while (tryD <= kLastDir) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
tryD = kFirstDir;
while (tryD <= lastTried) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
return kNoDir; // zero, no possible exit found nearby
}


TotallyUnknown
// returns true if every move leads to an unknown square
// this is only possible at the beginning and after falling
// at least three below our last position.
static Boolean
TotallyUnknown(const long x, const long y, const long z,
 const long xSize, const long xySize, char *m)
{
dirT dir;
/* loop through the directions until we find a known spot */
for (dir = kFirstDir; dir <= kLastDir; dir++) {
 const long dx = d2x(dir);
 const long dy = d2y(dir);
 const long dz = d2z(dir);
 if (!myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xySize)))
 return false;
 }
return true;
}


MoveTowardsNearWall
// Pick a move that is towards a near wall
// (NOTE: only used when all directions are unknown)
static dirT
MoveTowardsNearWall(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (m)
long distx = xSize - x - 1; // distance from x==xMax edge
long disty = ySize - y - 1; // distance from y==yMax edge
long distz = zSize - z - 1; // distance from z==zMax edge
// [xyz] is distance from [xyz]==0 edge
long dx, dy, dz;
long xy = xSize * ySize;

if (x < distx) dx = -1;
else if (x == distx) dx = 0;
else dx = 1;
if (y < disty) dy = -1;
else if (y == disty) dy = 0;
else dy = 1;
if (z < distz) dz = -1;
else if (z == distz) dz = 0;
else dz = 1;

return di[dy+1][dz+1][dx+1];
}


Gravity
// Fall until we find a floor below us
// Only use after mapping new knowledge
// (Don’t use during mapping)
static long
Gravity(long i, const char *m, const long xySize)
{
do {i -= xySize;}
 while (kWall != *(m + i));
 
return i + xySize;
}


SearchOneSquare
// Search from this square for an adjacent unknown square
// queueing up moveable squares (including spaces below
// falls) for further research later,
// marking enqueued squares as ‘tried’ (immediately meaning
// ‘not-to-be-queued-for-trying’, later ‘actually-tried’)
// NOTE: while I could mark falls as tried (upward from
// every space) they are rather unlikely to be in the
// search path, so it’s not worth it.  Just re-enact
// gravity each time, and check last square for ‘tried’.
static Boolean
SearchOneSquare(STNPtr startSTN,
 const long xSize, const long xySize, char *m)
{
dirT d;
const long startSquare = startSTN->square;

for (d = kFirstDir; d <= kLastDir; d++) {
 const long sqi = startSquare + offsetD(d,xSize,xySize);
 const char sq = *(m + sqi);
 if (myIsUnknown(sq)) {
 SetBestMove(startSTN, d);
 return true;
 }
 else if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,sqi,d);
 *(m + sqi) = kTriedSpace;
 }
 else if (myIsUntriedFall(sq)) {
 const long bottomSqi = Gravity(sqi,m,xySize);
 const long bottomSq = *(m + bottomSqi);
 if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,bottomSqi,d);
 *(m + bottomSqi) = kTriedSpace;
 }
    //else if (myIsUnknown(bottomSq)) {
    //    BreakToSourceDebugger_(); // should be impossible
    //    return true; //??
    //    }
 else ; //it’s an already tried space, do nothing
 }
 else ; // it’s a wall or already tried space, do nothing
 }
return false;
}


FindNearestUnknown
// Find a move sequence that will lead to an unknown
// square (preferably an edge square?).
static dirT
FindNearestUnknown(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (zSize)
const long xySize = xSize * ySize;
Boolean found = false;
// make new search tree with square at x,y,z
NewSearchTree();
NewBestMoveList();
gTreeRoot->parent = nil;
gTreeRoot->square = offsetXYZ(x,y,z,xSize,xySize);
gTreeRoot->direction = kNoDir;
*(m + gTreeRoot->square) = kTriedSpace;
// fan out from this one layer at a time
while (!isEmptySearchQ() && !found) {
 STNPtr tryNode = DeQ();
 found = SearchOneSquare(tryNode, xSize, xySize, m);
    //FreeSTN(tryNode);
 }
DisposeSearchTree(m);
// found move(list) or failed
return found;
}


CalcBestMove
// Calculate the best move to try
// return true if we have found an exit or are at wit’s end
static dirT
CalcBestMove(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
static dirT lastTried = kNoDir;
dirT d;

if (!isEmptyMoveList()) { // we have a pre-made list of moves

 
AAPL
$531.70
Apple Inc.
+0.53
MSFT
$39.99
Microsoft Corpora
+0.05
GOOG
$534.81
Google Inc.
+6.19

MacTech Search:
Community Search:

Software Updates via MacUpdate

Viber 4.1.0 - Send messages and make cal...
Viber lets you send free messages and make free calls to other Viber users, on any device and network, in any country! Viber syncs your contacts, messages and call history with your mobile device,... Read more
Apple iOS 7.1.1 - The latest version of...
The latest version of iOS can be downloaded through iTunes. Apple iOS 7 brings an all-new design and all-new features. Simplicity Simplicity is often equated with minimalism. Yet true simplicity is... Read more
1Password 4.3 - Powerful password manage...
1Password is a password manager that uniquely brings you both security and convenience. It is the only program that provides anti-phishing protection and goes beyond password management by adding Web... Read more
Lens Blur 1.3.0 - True out-of-focus boke...
Let Lens Blur transform your existing photo into true SLR-quality out-of-focus bokeh effect! Everyone needs a gorgeous personalized background for a social profile, blog, Web/UI design, presentation... Read more
VMware Fusion 6.0.3 - Run Windows apps a...
VMware Fusion allows you to create a Virtual Machine on your Mac and run Windows (including Windows 8.1) and Windows software on your Mac. Run your favorite Windows applications alongside Mac... Read more
Tweetbot 1.5.1 - Popular iOS twitter cli...
Tweetbot is a full-featured OS X Twitter client with a lot of personality. Whether it's the meticulously-crafted interface, sounds and animation, or features like multiple timelines and column views... Read more
Mac DVDRipper Pro 4.1.7 - Copy, backup,...
Mac DVDRipper Pro is the DVD backup solution that lets you protect your DVDs from scratches, save your batteries by reading your movies from your hard disk, manage your collection with just a few... Read more
PDFpenPro 6.2 - Advanced PDF toolkit for...
PDFpenPro allows users to edit PDF's easily. Add text, images and signatures. Fill out PDF forms. Merge or split PDF documents. Reorder and delete pages. Even correct text and edit graphics! Create... Read more
PDFpen 6.2 - Edit and annotate PDFs with...
PDFpen allows users to easily edit PDF's. Add text, images and signatures. Fill out PDF forms. Merge or split PDF documents. Reorder and delete pages. Even correct text and edit graphics! Features... Read more
Monolingual 1.5.9 - Remove unwanted OS X...
Monolingual is a program for removing unnecesary language resources from OS X, in order to reclaim several hundred megabytes of disk space. It requires a 64-bit capable Intel-based Mac and at least... Read more

Latest Forum Discussions

See All

Zeebox is Now Beamly TV – Still Offers t...
Zeebox is Now Beamly TV – Still Offers the Same Social Networking TV Fun, Plus a New Look Posted by Rob Rich on April 22nd, 2014 [ permalink ] | Read more »
Bandai Namco Unveils Upcoming Slate of M...
At their recent Global Gamers’ Day event, Bandai Namco was largely focused on their console and PC offerings for the upcoming year. However mobile still had a small presence, with some upcoming titles revealed by the company – though few were in a... | Read more »
The Story Behind Grammar Girl’s Grammar...
Learning is so much more rewarding when it’s also fun. That’s part of the reason why recent educational app, Grammar Pop HD, garnered such a positive review from us last week. The brainchild of Mignon Fogarty, otherwise known as Grammar Girl, we... | Read more »
Pinnacle Studio for iPhone Review
Pinnacle Studio for iPhone Review By Jennifer Allen on April 22nd, 2014 Our Rating: :: SIMPLY POWERFULiPhone App - Designed for the iPhone, compatible with the iPad Video editing while on the move has never been so convenient.   | Read more »
Taste Savant Review
Taste Savant Review By Jennifer Allen on April 22nd, 2014 Our Rating: :: TASTY RECOMMENDATIONSiPhone App - Designed for the iPhone, compatible with the iPad In need of some new restaurant recommendations? This app will be ideal,... | Read more »
Where’s My Water? Featuring XYY Adds Mor...
Where’s My Water? Featuring XYY Adds More Than Just Sheep to the Liquid Physics Puzzler Posted by Rob Rich on April 22nd, 2014 [ permalink ] | Read more »
FarmVille 2: Country Escape Review
FarmVille 2: Country Escape Review By Jennifer Allen on April 22nd, 2014 Our Rating: :: STEADY FARMINGUniversal App - Designed for iPhone and iPad FarmVille is bigger and brighter than ever before, but don’t expect it to sway you... | Read more »
Doctor Who: Legacy receives big update,...
Doctor Who: Legacy receives big update, adds Perk System and more Posted by Tre Lawrence on April 22nd, 2014 [ permalink ] Universal App - Designed for iPhone and iPad | Read more »
Strongarm Universal Mount Hardware Revie...
Made by: Viatek Price: $14.99 for 2 Hardware/iOS Integration Rating: 3.5 out of 5 stars Usability Rating: 4 out of 5 stars Reuse Value Rating: 3.75 out of 5 stars Build Quality Rating: 3.5 out of 5 stars Overall Rating: 3.69 out of 5 stars | Read more »
Boxer Review
Boxer Review By Campbell Bird on April 21st, 2014 Our Rating: :: KO YOUR INBOXUniversal App - Designed for iPhone and iPad Turn your inbox into a task list or tune it to your own needs with this highly customizable, user friendly... | Read more »

Price Scanner via MacPrices.net

Everything You Wanted To Know And Probably Mo...
Macworld UK’s Lou Hattersley takes a look inside Apple’s A7 System On Chip (SoC) , noting that its processor module is much more powerful than other smartphone chipsets. He notes that the A7 was a... Read more
2.5GHz Mac mini, Apple refurbished, available...
The Apple Store has Apple Certified Refurbished 2.5GHz Mac minis available for $509, $90 off MSRP. Apple’s one-year warranty is included, and shipping is free. Read more
13-inch MacBook Pro, Apple refurbished, avail...
The Apple Store continues to offer Apple Certified Refurbished 13″ 2.5GHz MacBook Pros (4GB RAM/500GB HD) for $999 which is $200 off MSRP. Apple’s one-year warranty is included, and shipping is free. Read more
15-inch MacBook Pros (refurbished) available...
The Apple Store has Apple Certified Refurbished October 2013 15″ Retina MacBook Pros available starting at $1699, with models up to $400 off MSRP. Apple’s one-year warranty is standard, and shipping... Read more
$100 off cellular iPad minis plus free $20 gi...
Best Buy is discounting cellular iPad minis with Retina Displays by $100 on their online store for a limited time. They’ll also throw in a free $20 Best Buy gift card. Choose free shipping or free... Read more
Updated Price Trackers
We’ve updated our Mac Price Trackers with the latest information on prices, bundles, and availability on systems from Apple’s authorized internet/catalog resellers: - 15″ MacBook Pros - 13″ MacBook... Read more
Apple refurbished MacBook Airs available for...
The Apple Store has Apple Certified Refurbished 2013 MacBook Airs available for up to $200 off the cost of new models. An Apple one-year warranty is included with each MacBook, and shipping is free... Read more
Android Leads in Operating System Share Andro...
Consumer Intelligence Research Partners, LLC (CIRP) has released its latest results of its research on mobile phone operating systems for the calendar quarter that ended March 31, 2014. This analysis... Read more
Pelican Products, Inc. Introduces New Lineup...
Pelican Products, Inc., the global leader in the design and manufacture of high-performance protective cases, today announced the launch of a new line of rugged phone cases for both the Apple iPhone... Read more
SaveDrives – Car Dashboard Video Camera &...
Drivers who want to help reduce potential damage to their health and finances in the event of an accident can download the innovative new no-cost app SaveDrives – Car Dashboard Video Camera &... Read more

Jobs Board

*Apple* Solutions Consultant (ASC) - Apple (...
**Job Summary** The ASC is an Apple employee who serves as an Apple brand ambassador and influencer in a Reseller's store. The ASC's role is to grow Apple Read more
Position Opening at *Apple* - Apple (United...
…customers purchase our products, you're the one who helps them get more out of their new Apple technology. Your day in the Apple Store is filled with a range of Read more
*Apple* Solutions Consultant (ASC) - Apple (...
**Job Summary** The ASC is an Apple employee who serves as an Apple brand ambassador and influencer in a Reseller's store. The ASC's role is to grow Apple Read more
*Apple* Inc. Research Data Specialist - Appl...
…of Worldwide Market Research & Intelligence. The team is responsible for conducting Apple branded consumer market research. It is also responsible for analyzing data Read more
*Apple* Automotive Parts Department position...
Apple Automotive is one of the fastest growing dealer…and it shows. Consider making the switch to the Apple Automotive Group today! At Apple Automotive, we Read more
All contents are Copyright 1984-2011 by Xplain Corporation. All rights reserved. Theme designed by Icreon.