TweetFollow Us on Twitter

Oct 96 Challenge
Volume Number:12
Issue Number:10
Column Tag:Programmer’s Challenge

Programmer’s Challenge

By Bob Boonstra

Note: Source code files accompanying article are located on MacTech CD-ROM or source code disks.

DNA Match

This month’s Challenge is based on a suggestion submitted by Vicente Giles of the Universidad de Málaga. Vincente faces a real-world problem to look for all the genomic sequences that match certain

criteria, given a DNA database sequence and a problem sequence. A DNA sequence is a string of the four different nucleotides involved in the genetic code, denoted ‘A’, ‘C’, ‘G’, and ‘U’, which stand for adenine, cytosine, guanine, and uracil. The problem is to find all possible matches of the problem sequence in the database sequence, allowing a specified number of differences.

The prototype for the code you should write is:

long FindMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage,  /* storage preallocated for your use */
 char *fragment, /* string to match against database */
 long diffsAllowed,/* differences allowed between fragment and database */
 long matchPosition[]/* return match positions in this array*/
);

void InitMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage   /* storage preallocated for your use */
);

Because we would like our DNA-matching algorithm to be useful even if scientists discover an extraterrestrial genetic code based on other nucleotides, the algorithm accepts the genetic alphabet as a parameter. In the problem posed by Vincente, this would be the string “ACGU”, but in our Challenge it might include any of the characters ‘a’..’z’ or ‘A’..’Z’ (Extraterrestrial DNA is case sensitive). The null-terminated reference string contained in the database parameter can be up to 1000000000 (109) characters long. The fragment that you are to match is also null-terminated, but will be significantly shorter on average (up to 10000 characters) than the database string. You should compare the input fragment against database, finding all occurrences of fragment that differ in no more than diffsAllowed positions from a substring of database. Your code should populate one entry in the preallocated matchPosition array for each match found, storing the offset of the character in database that corresponds to the first character of fragment. The FindMatch function should return the number of matches found.

As an example, given the following input

alphabet: ACGU

database: ACGTACGTACGTAAAAAATACGTACGTATA

fragment: ACGTACGTAC

diffsAllowed: 5

your code should find 7 matches and store the following values in matchPosition:

-4 0 4 8 15 19 23


Notice that partial matches can occur at the beginning or the end of database, and as a result, the offsets returned in matchPosition can be negative or greater than strlen(database) - strlen(fragment).

To allow you to do some preprocessing, your InitMatch routine will be called once before a sequence of calls to FindMatch. InitMatch will be called with the same alphabet and database parameters provided to subsequent FindMatch calls. Both routines will also be given the same storage parameter that points to at least 1MB of memory allocated and initialized to zero by the calling routine. FindMatch will be called between 100 and 1000 times, on average, for each call to InitMatch. The winning solution will be the one with the fastest execution time, including the execution time for both InitMatch and FindMatch.

Other fine print: The alphabet characters will be provided in increasing ASCII order. The offsets you store in matchPosition need not be in any particular order. The value for diffsAllowed will typically be smaller than 50% of strlen(fragment). Finally, you should not allocate any dynamic storage in your solution beyond that provided in the storage parameter.

This will be a native PowerPC Challenge using the latest Symantec environment. Solutions may be coded in C or C++.

Two Months Ago Winner

Congratulations to Randy Boring for submitting the fastest entry to the A-Maze-ing Programmer’s Challenge. The Challenge this month was to write code that would find a path leading out of a three-dimensional maze. The solutions were provided with the maze size, an initial position, some storage for use in mapping the maze, and a callback routine. The callback provided the result of attempting to move in a given direction, indicating whether the attempt to move succeeded, failed because there was no opening in the specified direction, resulted in a fall down a shaft in the mine, or found an exit to the mine. Of the four entries submitted, only two successfully solved all of my test mazes; one of the entries crashed, and one went into an infinite loop.

The table below summarizes the results for each correct entry, including the language in which the solution was written, the size of the solution code, the amount of static data used by the solution, the total execution time for all test cases, and the number of moves needed to solve the mazes.

Name Language Code Size Data Size Time Moves

Randy Boring C++ 2792 484 343153 33519

Jay Negro C++ 1788 51 40945114 7120802

The test mazes used in the evaluation ranged in size from 10x20x30 to 100x100x200, and ranged in density (the percentage of open cells) from 10% to 20%. As indicated in the problem statement, a path to an exit was guaranteed to exist from any cell reachable from the starting position.

Randy’s winning entry spent more time processing each move than the second place entry from first-time Challenge contestant Jay Negro, but Randy’s code solved the maze using significantly fewer moves and executed two orders of magnitude more quickly. His code maintains a queue of what are believed to be the best moves to try. As long as there are moves in the best move list, it invokes the callback with the best move, checks for success, and then updates the map with what it has learned about the maze position it just tried. The CalcBestMove routine determines the best possible move (surprise!) by first moving toward an adjacent maze boundary if one exists, or moving toward the nearest maze boundary if nothing is known about the current position, or trying adjacent positions about which nothing is known, or finally by moving toward a position about which nothing is known. The CalcBestMove heuristics, along with judicious use of inline functions and some optimization of maze offset calculations, combined to make this an efficient solution.

Careful readers of the code will note one potential problem with the Initialize routine, in that it simply gives up and returns if it is unable to allocate enough memory. This could have caused the winning entry to fail for larger mazes when given only the amount of memory guaranteed by the problem. However, the size of the mazes that I could practically evaluate was limited by the speed of the other entries, and the memory problem did not show up with those cases, so I elected to ignore it. Under other circumstances, proper handling of low memory conditions would have been required to win.

TOP 20 CONTESTANTS

Here are the Top 20 Contestants for the Programmer’s Challenge. The numbers below include points awarded over the 24 most recent contests, including points earned by this month’s entrants.

RankNamePoints
1.Munter, Ernst193
2.Gregg, Xan92
3.Larsson, Gustav87
4.[Name deleted]60
5.Lengyel, Eric40
6.Lewis, Peter30
7.Boring, Randy27
8.Beith, Gary24
9.Kasparian, Raffi22
10.Vineyard, Jeremy22
11.Cutts, Kevin21
12.Picao, Miguel Cruz21
13.Brown, Jorg20
14.Gundrum, Eric20
15.Karsh, Bill19
16.Stenger, Allen19
17.Cooper, Greg17
18.Mallett, Jeff17
19.Nevard, John17
20.Nicolle, Ludovic14

There are three ways to earn points: (1) scoring in the top 5 of any Challenge, (2) being the first person to find a bug in a published winning solution or, (3) being the first person to suggest a Challenge that I use. The points you can win are:

1st place20 points
2nd place10 points
3rd place7 points
4th place4 points
5th place2 points
finding bug2 points
suggesting Challenge2 points

Here is Randy’s winning solution:

Amazing.cp

Copyright © 1996 Randy Boring

typedef Boolean (*MoveProc) (
 long xMove,long yMove,long zMove,
 long *newXPos,long *newYPos,long *newZPos
 );

// the MoveProc, MakeAMove, is a callback.  It returns true if you 
// have found your way out of the maze.
// You give it (x,y,z) as a delta from your current position,
// each from [-1, 0, 1].  Straight up and straight down (and all zeroes)
// always result in no movement. 

Boolean Maze (long xMove, // these are your initial position
 long yMove,
 long zMove,
 long xSize,// these are the dimensions of the maze
 long ySize,
 long zSize,
 MoveProc MakeAMove, // this is your callback routine
 char *mapStorage// this is your preallocated storage
 );// (one char per position in maze)

Typedefs and Constants
typedef long dirT; // direction enumerator (0-24)

static
const long dir2dx[25]={9,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,};
static
const long dir2dy[25]={9, 
 1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,};
static
const long dir2dz[25]={9,
  1, 1, 1,   1, 1,   1, 1, 1,
  0, 0, 0,   0, 0,   0, 0, 0,
 -1,-1,-1,  -1,-1,  -1,-1,-1,};
static
const dirT di[3][3][3] = {
  {{1,2,3},{4,0,5},{6,7,8}},
  {{9,10,11},{12,0,13},{14,15,16}},
  {{17,18,19},{20,0,21},{22,23,24}}};
static const dirT kNoDir = 0;
static const dirT kFirstDir = 1;
static const dirT kLastDir = 24;
static const dirT kNumDirs = 25; // including kNoDir at zero
static const char kUnknown = 0;  // unknown square
    // every type below is known
static const char kWall = 1;// wall
static const char kSpace = 2; // space-above-wall
static const char kFall = 4;// space-above-space
static const char kTriedSpace = 10;// searched space
static const char kTriedFall = 12; // searched fall

static const short kTakeProb = 4;  // 1/4th
static const long kSTNBlockSize = 48;

typedef long squareIndexT;
typedef struct STN {
 struct STN *parent;
 squareIndexT square;// square index of this node
 dirT   direction; // how I got here from my parent
 } SearchTreeNode, *STNPtr, **STNHandle;

Globals
static STNPtr gTreeRoot;
static STNPtr gTreeTop;
static STNPtr gQHead;
static STNPtr gQTail;
static STNPtr gBestMoveList;
static STNHandle gTreeRootH;
static STNHandle gBestMoveListH;
static STNPtr gBestMoveListNextPos;

Defines 
#define myIsUnknown(sq) (kUnknown == (sq))
#define myIsKnown(sq)(kUnknown != (sq))
    // the below should only be used when the square is known
#define myIsWall(sq) (kWall == (sq))
#define myIsUntriedWalkable(sq)  (kSpace == (sq))
#define myIsOpen(sq) (0x00 == (0x01 & (sq)))
#define myIsWalkable(sq) (0x02 == (0x02 & (sq)))
#define myIsUntriedFall(sq) (kFall == (sq))
#define myIsFall(sq) (0x04 == (0x04 & (sq)))
#define myIsTried(sq)(0x08 == (0x08 & (sq)))
#define d2x(d) (dir2dx[d])
#define d2y(d) (dir2dy[d])
#define d2z(d) (dir2dz[d])
#define xvec(d) (d2x(d))
#define yvec(d,xN) (d2y(d) * (xN))
#define zvec(d,xyN) (d2z(d) * (xyN))
#define offsetD(d,xN,xyN) (xvec(d) + yvec(d,xN) + zvec(d,xyN))
#define offsetXYZ(x,y,z,xN,xyN) ((x) + (y) * xN + (z) * (xyN))
#define map(m,x,y,z,xN,xyN) (*(m + (x) + (y) * xN + (z) * (xyN)))

#ifdef powerc
#define BreakToSourceDebugger_()   Debugger()
#else   // 68K
#define BreakToSourceDebugger_()   SysBreak()
#endif  // powerc


isEmptySearchQ
static inline Boolean
isEmptySearchQ() {return (gQHead == gQTail);}

isFullSearchQ
static inline Boolean
isFullSearchQ() {return (gTreeTop <= gQTail);}

DeQ
static inline STNPtr
DeQ(void) {return gQHead++;}

EnQ
static inline STNPtr
EnQ(void) {
 STNPtr p = gQTail++;
    //if (isFullSearchQ())
    //    BreakToSourceDebugger_();
 return (p);
}

EnQNewCandidate
// Add this move (direction to a square index) to the tree at the current node, assumes 
// the square index has not already been visited by this search.
static void
EnQNewCandidate(STNPtr parent, const long sqi, 
 const dirT d)
{
STNPtr newNode = EnQ();
newNode->parent = parent;
newNode->direction = d;
newNode->square = sqi;
}

isEmptySearchTree
static inline Boolean
isEmptySearchTree() {return (gTreeRoot == gQTail);}

PopSearchTree
static inline long
PopSearchTree(void) {return ((-gQTail)->square);}

NewSearchTree
static void
NewSearchTree(void) {
 gQTail = gQHead = gTreeRoot;
 gQTail++;// the only time we’re called,
}//  gTreeRoot is immediately the EnQed elem.

DisposeSearchTree
static void
DisposeSearchTree(char *m) {
while (!isEmptySearchTree()) {
    // remove ‘tried’ mark
 *(m + PopSearchTree()) = kSpace;
 }
}

isEmptyMoveList
static inline Boolean
isEmptyMoveList()
 {return (gBestMoveListNextPos == gBestMoveList);}

PushMoveList
static inline void
PushMoveList(const dirT d) {
 gBestMoveListNextPos->direction = d;
 gBestMoveListNextPos++;}

PopMoveList
static inline dirT
PopMoveList(void) {
 -gBestMoveListNextPos;
 return (gBestMoveListNextPos->direction);}

NewBestMoveList
static void
NewBestMoveList(void) {gBestMoveListNextPos = gBestMoveList;}

SetBestMove
// Copy the sequence of best directions-to-move to the
// best move list.  (The tree is about to be freed.)
static void
SetBestMove(STNPtr node, const dirT d)
{
PushMoveList(d);
while (kNoDir != node->direction) { // the root’s dir
 PushMoveList(node->direction);
 node = node->parent;
 }
}

Initialize
// Initialize everything for the routine
// map is already initialized to zeroes (kUnknown == 0)
static Boolean
Initialize(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
const long xySize = xSize * ySize;
long treeBytesWanted = sizeof(SearchTreeNode)
 * ((xSize - 2) * (ySize - 2) * (zSize - 2) + 4);
long treeBytesNeeded = sizeof(SearchTreeNode)
 * ((xSize - 2) + (ySize - 2) + (zSize - 2) + 1);
Boolean succeed = true;

map(m,x,y,z,xSize,xySize) = kSpace;
map(m,x,y,z-1,xSize,xySize) = kWall;

gBestMoveListH = (STNHandle) NewHandle(sizeof(SearchTreeNode)
 * (zSize + xySize) * 2);
if (!gBestMoveListH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gBestMoveListH);
gBestMoveList = *gBestMoveListH;

do {
 gTreeRootH = (STNHandle) NewHandle(treeBytesWanted);
 treeBytesWanted *= 0.9;
 }
 while (!gTreeRootH && 
 (treeBytesNeeded <= treeBytesWanted));
if (!gTreeRootH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gTreeRootH);
gTreeRoot = *gTreeRootH;

NewBestMoveList();
return succeed;
}


DeInitialize
// Free everything we allocated
static void
DeInitialize()
{
HUnlock((Handle) gBestMoveListH);
DisposeHandle((Handle) gBestMoveListH);
HUnlock((Handle) gTreeRootH);
DisposeHandle((Handle) gTreeRootH);
}


AtEdge
// Are we at an edge?
// return true if we are
static Boolean
AtEdge(const long x, const long y, const long z,
 const long xMax, const long yMax, const long zMax)
{
if (0==x || 0==y || 0==z) return true;
if (xMax==x || yMax==y || zMax==z) return true;
return false;
}


MapMove
// Map the move we just made/tried.
// I.e., store our new knowledge of the maze in the map
static void
MapMove(const long oldx, const long oldy, const long oldz,
 const long newx, const long newy, const long newz,
 char *m, const long xN, const long xyN,
 const long dx, const long dy, const long dz)
{
long x = oldx + dx; // where we tried to move
long y = oldy + dy; // (we need these in either case below)
long z = oldz + dz;
long sqi = offsetXYZ(x, y, z, xN, xyN);
if (newx==oldx && newy==oldy && newz==oldz) { // bump!
    // mark as wall the square we bumped into
 *(m + sqi) = kWall;
    // lastTried was not successful
    //gLastWasSuccess = false;
 }
else {
    // mark as clear any squares we fell through
    // actually mark them with as fall because they can’t
    // really be moved ‘to’ only through, downwards.
 if (newz < z) {
 do {
 *(m + sqi) = kFall;
 z-;
 sqi -= xyN;
 } while (newz < z);
 }
    // mark as clear our current space
 *(m + sqi) = kSpace;
    // mark as ‘wall’ the square we are standing on
 sqi -= xyN;
 *(m + sqi) = kWall;
    // lastTried was successful
    //gLastWasSuccess = true;
    // direction of last success
    //gLastSuccess = lastTried;
 }
}


APossibleExit
// return a direction in which
// there may be an adjacent exit.
// A possible exit must be both an edge and untried.
static dirT
APossibleExit(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m, dirT lastTried)
{
dirT tryD = lastTried + 1; // start here
/* check for edge conditions first */
if (x > 1 && x < xSize - 2)
 if (y > 1 && y < ySize - 2)
 if (z > 1 && z < zSize - 2)
    /* no exits are possibly nearby */
    /* because no edges are nearby */
 return kNoDir; // zero

/* search the adjacent spaces for a possible exit */
/* this could improve a lot */
while (tryD <= kLastDir) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
tryD = kFirstDir;
while (tryD <= lastTried) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
return kNoDir; // zero, no possible exit found nearby
}


TotallyUnknown
// returns true if every move leads to an unknown square
// this is only possible at the beginning and after falling
// at least three below our last position.
static Boolean
TotallyUnknown(const long x, const long y, const long z,
 const long xSize, const long xySize, char *m)
{
dirT dir;
/* loop through the directions until we find a known spot */
for (dir = kFirstDir; dir <= kLastDir; dir++) {
 const long dx = d2x(dir);
 const long dy = d2y(dir);
 const long dz = d2z(dir);
 if (!myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xySize)))
 return false;
 }
return true;
}


MoveTowardsNearWall
// Pick a move that is towards a near wall
// (NOTE: only used when all directions are unknown)
static dirT
MoveTowardsNearWall(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (m)
long distx = xSize - x - 1; // distance from x==xMax edge
long disty = ySize - y - 1; // distance from y==yMax edge
long distz = zSize - z - 1; // distance from z==zMax edge
// [xyz] is distance from [xyz]==0 edge
long dx, dy, dz;
long xy = xSize * ySize;

if (x < distx) dx = -1;
else if (x == distx) dx = 0;
else dx = 1;
if (y < disty) dy = -1;
else if (y == disty) dy = 0;
else dy = 1;
if (z < distz) dz = -1;
else if (z == distz) dz = 0;
else dz = 1;

return di[dy+1][dz+1][dx+1];
}


Gravity
// Fall until we find a floor below us
// Only use after mapping new knowledge
// (Don’t use during mapping)
static long
Gravity(long i, const char *m, const long xySize)
{
do {i -= xySize;}
 while (kWall != *(m + i));
 
return i + xySize;
}


SearchOneSquare
// Search from this square for an adjacent unknown square
// queueing up moveable squares (including spaces below
// falls) for further research later,
// marking enqueued squares as ‘tried’ (immediately meaning
// ‘not-to-be-queued-for-trying’, later ‘actually-tried’)
// NOTE: while I could mark falls as tried (upward from
// every space) they are rather unlikely to be in the
// search path, so it’s not worth it.  Just re-enact
// gravity each time, and check last square for ‘tried’.
static Boolean
SearchOneSquare(STNPtr startSTN,
 const long xSize, const long xySize, char *m)
{
dirT d;
const long startSquare = startSTN->square;

for (d = kFirstDir; d <= kLastDir; d++) {
 const long sqi = startSquare + offsetD(d,xSize,xySize);
 const char sq = *(m + sqi);
 if (myIsUnknown(sq)) {
 SetBestMove(startSTN, d);
 return true;
 }
 else if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,sqi,d);
 *(m + sqi) = kTriedSpace;
 }
 else if (myIsUntriedFall(sq)) {
 const long bottomSqi = Gravity(sqi,m,xySize);
 const long bottomSq = *(m + bottomSqi);
 if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,bottomSqi,d);
 *(m + bottomSqi) = kTriedSpace;
 }
    //else if (myIsUnknown(bottomSq)) {
    //    BreakToSourceDebugger_(); // should be impossible
    //    return true; //??
    //    }
 else ; //it’s an already tried space, do nothing
 }
 else ; // it’s a wall or already tried space, do nothing
 }
return false;
}


FindNearestUnknown
// Find a move sequence that will lead to an unknown
// square (preferably an edge square?).
static dirT
FindNearestUnknown(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (zSize)
const long xySize = xSize * ySize;
Boolean found = false;
// make new search tree with square at x,y,z
NewSearchTree();
NewBestMoveList();
gTreeRoot->parent = nil;
gTreeRoot->square = offsetXYZ(x,y,z,xSize,xySize);
gTreeRoot->direction = kNoDir;
*(m + gTreeRoot->square) = kTriedSpace;
// fan out from this one layer at a time
while (!isEmptySearchQ() && !found) {
 STNPtr tryNode = DeQ();
 found = SearchOneSquare(tryNode, xSize, xySize, m);
    //FreeSTN(tryNode);
 }
DisposeSearchTree(m);
// found move(list) or failed
return found;
}


CalcBestMove
// Calculate the best move to try
// return true if we have found an exit or are at wit’s end
static dirT
CalcBestMove(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
static dirT lastTried = kNoDir;
dirT d;

if (!isEmptyMoveList()) { // we have a pre-made list of moves

 

Community Search:
MacTech Search:

Software Updates via MacUpdate

Quicken 4.4.2 - Complete personal financ...
Quicken makes managing your money easier than ever. Whether paying bills, upgrading from Windows, enjoying more reliable downloads, or getting expert product help, Quicken's new and improved features... Read more
Adobe Illustrator CC 2017 21.0.2 - Profe...
Illustrator CC 2017 is available as part of Adobe Creative Cloud for as little as $19.99/month (or $9.99/month if you're a previous Illustrator customer). Adobe Illustrator CC 2017 is the industry... Read more
Paparazzi! 1.0b2 - Make user-defined siz...
Paparazzi! is a small utility for OS X that makes screenshots of webpages. This very simple tool takes screenshots of websites which do not fit on one screen. You specify the desired width, minimal... Read more
Monodraw 1.2.1 - Powerful ASCII art edit...
Monodraw allows you to easily create text-based art (like diagrams, layouts, flow charts) and visually represent algorithms, data structures, binary formats and more. Because it's all just text, it... Read more
Monodraw 1.2.1 - Powerful ASCII art edit...
Monodraw allows you to easily create text-based art (like diagrams, layouts, flow charts) and visually represent algorithms, data structures, binary formats and more. Because it's all just text, it... Read more
Iridient Developer 3.1.3 - Powerful imag...
Iridient Developer (was RAW Developer) is a powerful image conversion application designed specifically for OS X. Iridient Developer gives advanced photographers total control over every aspect of... Read more
beaTunes 4.6.11 - Organize your music co...
beaTunes is a full-featured music player and organizational tool for music collections. How well organized is your music Library? Are your artists always spelled the same way? Any R.E.M. vs REM?... Read more
Typinator 7.1 - Speedy and reliable text...
Typinator turbo-charges your typing productivity. Type a little. Typinator does the rest. We've all faced projects that require repetitive typing tasks. With Typinator, you can store commonly used... Read more
Geekbench 4.0.4 - Measure processor and...
Geekbench provides a comprehensive set of benchmarks engineered to quickly and accurately measure processor and memory performance. Designed to make benchmarks easy to run and easy to understand,... Read more
Skype 7.44.0.364 - Voice-over-internet p...
Skype allows you to talk to friends, family and co-workers across the Internet without the inconvenience of long distance telephone charges. Using peer-to-peer data transmission technology, Skype... Read more

ROME: Total War - Barbarian Invasion set...
To the delight of mobile strategy fans, Feral Interactive released ROME: Total War just a few months ago. Now the game's expansion, Barbarian Invasion is marching onto iPads as a standalone release. [Read more] | Read more »
Yuri (Games)
Yuri 1.0 Device: iOS iPhone Category: Games Price: $3.99, Version: 1.0 (iTunes) Description: It's night. Yuri opens his eyes. He wakes up in a strange forest.The small, courageous explorer rides on his bed on casters in this... | Read more »
Space schmup Xenoraid launches on the Ap...
10Tons Xenoraid is out today on the App Store, bringing some high-speed space action to your mobile gadgets just in time for the weekend. The company's last premium title, another sci-fi game titled Neon Chrome, did quite well for itself, so... | Read more »
Star Wars: Force Arena Beginner's G...
Star Wars: Force Arena joined the populous ranks of Star Wars games on mobile today. It's a two-lane MOBA starring many familiar faces from George Lucas's famed sci-fi franchise. As with most games of this nature, Force Arena can be a little obtuse... | Read more »
Mysterium: The Board Game (Games)
Mysterium: The Board Game 1.0 Device: iOS Universal Category: Games Price: $6.99, Version: 1.0 (iTunes) Description: The official adaptation of the famous board game Mysterium! | Read more »
Sonny (Games)
Sonny 1.0.4 Device: iOS Universal Category: Games Price: $2.99, Version: 1.0.4 (iTunes) Description: Reimagined for iOS, cult-hit RPG Sonny brings challenging turn-based combat that requires strategy and mastery of each new skill to... | Read more »
Towaga (Games)
Towaga 1.0 Device: iOS iPhone Category: Games Price: $2.99, Version: 1.0 (iTunes) Description: "It has been foretold that a masked being would stand atop the legendary Towaga Temple, dwelling among shadows to fulfil The Black Moon... | Read more »
Bubble Witch 3 Saga Guide: How to get th...
King's bringing its fairytale bubble-popping puzzler back for its 3rd outing in Bubble Witch 3 Saga. If you're familiar with the series, not much has changed here on the surface level, though you'll likely be pleased with the improvements. If you'... | Read more »
Sunless Sea sails onto iPad this spring
Failbetter Games, the folks who brought you Fallen London, are celebrating their 7th birthday today. To commemorate the event, the team revealed that Sunless Sea is coming to iPad this spring. | Read more »
The Binding of Isaac: Rebirth (Games)
The Binding of Isaac: Rebirth 1.1 Device: iOS Universal Category: Games Price: $14.99, Version: 1.1 (iTunes) Description: Gameplay | Read more »

Price Scanner via MacPrices.net

12-inch 32GB Space Gray iPad Pro on sale for...
B&H Photo has 12″ Space Gray 32GB WiFi Apple iPad Pros on sale for $55 off MSRP including free shipping. B&H charges sales tax in NY only: - 12″ Space Gray 32GB WiFi iPad Pro: $744.44 $55 off... Read more
9-inch 32GB Space Gray iPad Pro on sale for $...
B&H Photo has the 9.7″ 32GB Space Gray Apple iPad Pro on sale for $549 for a limited time. Shipping is free, and B&H charges NY sales tax only. Read more
Apple iMacs on sale for up to $120 off MSRP,...
B&H Photo has 21″ and 27″ Apple iMacs on sale for up to $120 off MSRP, each including free shipping plus NY sales tax only: - 27″ 3.3GHz iMac 5K: $2199 $100 off MSRP - 27″ 3.2GHz/1TB Fusion iMac... Read more
Apple refurbished Apple TVs available for up...
Apple has Certified Refurbished 32GB and 64GB Apple TVs available for up to $30 off the cost of new models. Apple’s standard one-year warranty is included with each model, and shipping is free: -... Read more
1.4GHz Mac mini, refurbished, available for $...
The Apple Store has Apple Certified Refurbished 1.4GHz Mac minis available for $419. Apple’s one-year warranty is included, and shipping is free. Their price is $80 off MSRP, and it’s the lowest... Read more
16GB iPad Air 2, Apple refurbished, available...
Apple has Certified Refurbished 16GB iPad Air 2s available for $319 including free shipping. A standard Apple one-year is included. Their price is $60 off original MSRP for this model. Read more
Mac Pros on sale for $200 off MSRP, refurbish...
B&H Photo has Mac Pros on sale for $200 off MSRP. Shipping is free, and B&H charges sales tax in NY only: - 3.7GHz 4-core Mac Pro: $2799, $200 off MSRP - 3.5GHz 6-core Mac Pro: $3799, $200... Read more
Save with Apple refurbished iPad Pros, models...
Apple has Certified Refurbished 9″ and 12″ Apple iPad Pros available for up to $160 off the cost of new iPads. An Apple one-year warranty is included with each model, and shipping is free: - 32GB 9″... Read more
Amazon drops 12-inch Retina MacBook prices to...
Amazon has 2016 12″ Apple Retina MacBooks on sale for $300 off MSRP for a limited time. Shipping is free. The following configurations are available: - 12″ 1.1GHz Silver Retina MacBook: $999.99 $300... Read more
Cartella Slim Cases Put The ‘Book’ Back Into...
Minneapolis based Pad and Quill has just released the Cartella Slim Case for the 2016 Macbook Pro that puts the ‘book’ back into Macbooks! When you hold it, it looks & feels like an actual book…... Read more

Jobs Board

*Apple* & PC Desktop Support Technician...
Apple & PC Desktop Support Technician job in Los Angeles, CA Introduction: We have immediate job openings for several Desktop Support Technicians with one of our Read more
*Apple* Retail - Multiple Positions - Apple,...
Job Description: Sales Specialist - Retail Customer Service and Sales Transform Apple Store visitors into loyal Apple customers. When customers enter the store, Read more
*Apple* Premier Retailer - PT Service Specia...
DescriptionSimply Mac is the largest premier retailer for Apple products and solutions. At Simply Mac we are all Apple , all the time. Same products. Same prices. Read more
*Apple* Premier Retailer - Service Manager -...
DescriptionSimply Mac is the largest premier retailer for Apple products and solutions. At Simply Mac we are all Apple , all the time. Same products. Same prices. Read more
*Apple* Solutions Consultant - Apple (United...
# Apple Solutions Consultant Job Number: 54267729 Altamonte Springs, Florida, United States Posted: Jan. 6, 2017 Weekly Hours: 40.00 **Job Summary** As an Apple Read more
All contents are Copyright 1984-2011 by Xplain Corporation. All rights reserved. Theme designed by Icreon.